Scioly Assassination 14: Murder from Behind

[Assassinator]

Ichaelm, I would agree with the others in that you should not be allowed to play for a few games, but I will leave it up to the vote to decide.

Starpug was correct. I was getting fed up with mellolover thinking that (s)he could treat others like that so I decided it was his/her time to go. I took an air tank from my stock pile of SCUBA equipement and made a small, high pressure gun capable of firing a dart laced with a lethal poison at high speed. I got in position and fired. Nothing happened. I realized that I had forgotten to fill the tank with air. Last time I brought it in they wouldn't fill it because it had been over a year since its last visual inspection and I never got around to doing it. Dang.

TAATTCAGTTACCTACGCTGTGCT

The greatest code known to man.

[ichaelm]

Yep, it's confirmed. I'm banned from games 15 and 16. My vote didn't count. But I can still be in this one!

Oh, and its DNA or RNA.

[rocketman1555]

Here is the amino acid code, i'm working on finding the protein it codes for:

Ile Lys Ser Met Asp Ala Thr Arg

[ichaelm]

TAA TTC AGT TAC CTA CGC TGT GCT
UAA UUC AGU UAC CUA CGC UGU GCU

UAA (Stop) Ochre
UUC (Phe/F) Phenylalanine
AGU (Ser/S) Serine
UAC (Tyr/Y) Tyrosine
CUA (Leu/L) Leucine
CGC (Arg/R) Arginine
UGU (Cys/C) Cysteine
GCU (Ala/A) Alanine

Thats what I got.

Edit: nevermind, I did it wrong, rocketman was right.

[ichaelm]

I think we can safely conclude that the Assassin is in Crime Busters because the last clue was about the crime busters thread and this one is about DNA analysis. That really narrows it down.

[Aia]

I accuse Haven Chuck of being the assassinator because of his frequent posts in the Crimebuster thread and his related crimebuster knowledge.

[Deeisenberg]

.

[Assassinator]

I am not Haven Chuck. Sorry, that is a black mark for Aia. To see if my records are correct, please verify your number of black marks:

ichaelm: 2
vofbassist: 1
Aia: 1
starpug: 0
dudeincolorado: 0

[Aia]

I accuse genes_girl of being the assassinator because of extensive knowledge of genes and crimebusters.

(I edited only to change a spelling error- pet peeve. I didn't change my accusation)

[ichaelm]

Lol

And yes, that is correct. (the black marks, not Aia.)