Scioly Assassination 14: Murder from Behind
- Assassinator
- Posting Games Account
- Posts: 12
- Joined: August 15th, 2008, 8:02 am
- Has thanked: 9 times
- Been thanked: 811 times
- Contact:
Re: Scioly Assassination 14: Murder from Behind
Ichaelm, I would agree with the others in that you should not be allowed to play for a few games, but I will leave it up to the vote to decide.
Starpug was correct. I was getting fed up with mellolover thinking that (s)he could treat others like that so I decided it was his/her time to go. I took an air tank from my stock pile of SCUBA equipement and made a small, high pressure gun capable of firing a dart laced with a lethal poison at high speed. I got in position and fired. Nothing happened. I realized that I had forgotten to fill the tank with air. Last time I brought it in they wouldn't fill it because it had been over a year since its last visual inspection and I never got around to doing it. Dang.
TAATTCAGTTACCTACGCTGTGCT
The greatest code known to man.
Starpug was correct. I was getting fed up with mellolover thinking that (s)he could treat others like that so I decided it was his/her time to go. I took an air tank from my stock pile of SCUBA equipement and made a small, high pressure gun capable of firing a dart laced with a lethal poison at high speed. I got in position and fired. Nothing happened. I realized that I had forgotten to fill the tank with air. Last time I brought it in they wouldn't fill it because it had been over a year since its last visual inspection and I never got around to doing it. Dang.
TAATTCAGTTACCTACGCTGTGCT
The greatest code known to man.
Scioly Assassination 169: Why Is The H̶e̶a̶v̶y̶ Sciolyer Dead?!
Deaths: MJhowler, imcookiemonster, assassinator's will to live
Games currently on hold due to Discord account issues, sorry
Deaths: MJhowler, imcookiemonster, assassinator's will to live
Games currently on hold due to Discord account issues, sorry
- ichaelm
- Member

- Posts: 440
- Joined: October 23rd, 2008, 3:10 pm
- Division: Grad
- State: PA
- Has thanked: 0
- Been thanked: 0
- Contact:
Re: Scioly Assassination 14: Murder from Behind
Yep, it's confirmed. I'm banned from games 15 and 16. My vote didn't count.
But I can still be in this one! 
Oh, and its DNA or RNA.
Oh, and its DNA or RNA.
-
rocketman1555
- Staff Emeritus

- Posts: 577
- Joined: September 10th, 2006, 8:21 am
- Division: Grad
- Has thanked: 0
- Been thanked: 0
- Contact:
Re: Scioly Assassination 14: Murder from Behind
Here is the amino acid code, i'm working on finding the protein it codes for:
Ile Lys Ser Met Asp Ala Thr Arg
Ile Lys Ser Met Asp Ala Thr Arg
I am a practitioner of the art of magic known as science.
- ichaelm
- Member

- Posts: 440
- Joined: October 23rd, 2008, 3:10 pm
- Division: Grad
- State: PA
- Has thanked: 0
- Been thanked: 0
- Contact:
Re: Scioly Assassination 14: Murder from Behind
TAA TTC AGT TAC CTA CGC TGT GCT
UAA UUC AGU UAC CUA CGC UGU GCU
UAA (Stop) Ochre
UUC (Phe/F) Phenylalanine
AGU (Ser/S) Serine
UAC (Tyr/Y) Tyrosine
CUA (Leu/L) Leucine
CGC (Arg/R) Arginine
UGU (Cys/C) Cysteine
GCU (Ala/A) Alanine
Thats what I got.
Edit: nevermind, I did it wrong, rocketman was right.
UAA UUC AGU UAC CUA CGC UGU GCU
UAA (Stop) Ochre
UUC (Phe/F) Phenylalanine
AGU (Ser/S) Serine
UAC (Tyr/Y) Tyrosine
CUA (Leu/L) Leucine
CGC (Arg/R) Arginine
UGU (Cys/C) Cysteine
GCU (Ala/A) Alanine
Thats what I got.
Edit: nevermind, I did it wrong, rocketman was right.
- ichaelm
- Member

- Posts: 440
- Joined: October 23rd, 2008, 3:10 pm
- Division: Grad
- State: PA
- Has thanked: 0
- Been thanked: 0
- Contact:
Re: Scioly Assassination 14: Murder from Behind
I think we can safely conclude that the Assassin is in Crime Busters because the last clue was about the crime busters thread and this one is about DNA analysis. That really narrows it down.
-
Aia
- Wiki/Gallery Moderator Emeritus

- Posts: 235
- Joined: April 1st, 2006, 11:48 pm
- Division: Grad
- State: WA
- Has thanked: 0
- Been thanked: 0
Re: Scioly Assassination 14: Murder from Behind
I accuse Haven Chuck of being the assassinator because of his frequent posts in the Crimebuster thread and his related crimebuster knowledge.
Science Olympiad Alumna and Volunteer
Aia's Boomilever Guide: http://scioly.org/wiki/index.php/Aia%27 ... ever_Guide
Aia's Boomilever Guide: http://scioly.org/wiki/index.php/Aia%27 ... ever_Guide
- Deeisenberg
- Exalted Member

- Posts: 237
- Joined: April 29th, 2007, 7:23 pm
- Division: Grad
- State: PA
- Has thanked: 0
- Been thanked: 2 times
Re: Scioly Assassination 14: Murder from Behind
.
Last edited by Deeisenberg on December 20th, 2008, 5:45 pm, edited 2 times in total.
Events: Herpetology, Fossils, Entomology, Rocks & Minerals, Ornithology, Ecology
Nationals 2008: 1st in Herpetology
Nationals 2009: 1st in Herpetology, 2nd in Fossils
Harriton Class of 2010
Nationals 2008: 1st in Herpetology
Nationals 2009: 1st in Herpetology, 2nd in Fossils
Harriton Class of 2010
- Assassinator
- Posting Games Account
- Posts: 12
- Joined: August 15th, 2008, 8:02 am
- Has thanked: 9 times
- Been thanked: 811 times
- Contact:
Re: Scioly Assassination 14: Murder from Behind
I am not Haven Chuck. Sorry, that is a black mark for Aia. To see if my records are correct, please verify your number of black marks:
ichaelm: 2
vofbassist: 1
Aia: 1
starpug: 0
dudeincolorado: 0
ichaelm: 2
vofbassist: 1
Aia: 1
starpug: 0
dudeincolorado: 0
Scioly Assassination 169: Why Is The H̶e̶a̶v̶y̶ Sciolyer Dead?!
Deaths: MJhowler, imcookiemonster, assassinator's will to live
Games currently on hold due to Discord account issues, sorry
Deaths: MJhowler, imcookiemonster, assassinator's will to live
Games currently on hold due to Discord account issues, sorry
-
Aia
- Wiki/Gallery Moderator Emeritus

- Posts: 235
- Joined: April 1st, 2006, 11:48 pm
- Division: Grad
- State: WA
- Has thanked: 0
- Been thanked: 0
Re: Scioly Assassination 14: Murder from Behind
I accuse genes_girl of being the assassinator because of extensive knowledge of genes and crimebusters.
(I edited only to change a spelling error- pet peeve. I didn't change my accusation)
(I edited only to change a spelling error- pet peeve. I didn't change my accusation)
Last edited by Aia on December 20th, 2008, 5:43 pm, edited 2 times in total.
Science Olympiad Alumna and Volunteer
Aia's Boomilever Guide: http://scioly.org/wiki/index.php/Aia%27 ... ever_Guide
Aia's Boomilever Guide: http://scioly.org/wiki/index.php/Aia%27 ... ever_Guide
- ichaelm
- Member

- Posts: 440
- Joined: October 23rd, 2008, 3:10 pm
- Division: Grad
- State: PA
- Has thanked: 0
- Been thanked: 0
- Contact:
Re: Scioly Assassination 14: Murder from Behind
Lol
And yes, that is correct. (the black marks, not Aia.)
And yes, that is correct. (the black marks, not Aia.)
Who is online
Users browsing this forum: No registered users and 0 guests