Page 2 of 6
Re: Heredity B
Posted: November 9th, 2019, 8:37 am
by TikaKK
We were going through a test in class and came across a question that everyone got wrong. We don't agree with the answer key but wanted to know if anyone understands why the answer could possibly be that. If you know why or also disagree with the answer key please share your opinion.
The question is:
Given this mRNA code and the above chart, what amino acid sequence will be produced. For the diagram use the amino acid coding chart.
GGTUAAUGGUGAAGUCACCCCCCUGUGAACAAAUC
The answer key says the answer is supposed to be:
Meth, Val, Lys, Cys, Thr, Pro, Leu, Stop
We got:
Pro, Ile, Thr, Thr, Ser, Arg, Gly, Gly, Thr, Leu, Val, Stop
Re: Heredity B
Posted: November 9th, 2019, 12:16 pm
by Kraken
TikaKK wrote: ↑November 9th, 2019, 8:37 am
We were going through a test in class and came across a question that everyone got wrong. We don't agree with the answer key but wanted to know if anyone understands why the answer could possibly be that. If you know why or also disagree with the answer key please share your opinion.
The question is:
Given this mRNA code and the above chart, what amino acid sequence will be produced. For the diagram use the amino acid coding chart.
GGTUA
AUGGUGAAGUCACCCCCCUGUGAACAAAUC
The answer key says the answer is supposed to be:
Meth, Val, Lys, Cys, Thr, Pro, Leu, Stop
We got:
Pro, Ile, Thr, Thr, Ser, Arg, Gly, Gly, Thr, Leu, Val, Stop
Remember that AUG (bolded above) is the codon that initiates translation, so the protein would start with Methionine and move on until the stop codon.
Re: Heredity B
Posted: November 10th, 2019, 9:11 am
by TikaKK
Thank You!
Re: Heredity B
Posted: November 16th, 2019, 6:01 pm
by Phenakism
How much do we have to know about protein synthesis for this event?
Re: Heredity B
Posted: November 25th, 2019, 2:48 pm
by reninkidney
What are some common tiebreakers for this event? Are most tiebreakers time or some questions?
Re: Heredity B
Posted: November 30th, 2019, 8:18 pm
by bp31000
nnori19 wrote: ↑October 25th, 2019, 10:14 am
Hey does anyone know what some good online resources are, for heredity?
https://learn.genetics.utah.edu/
Re: Heredity B
Posted: December 26th, 2019, 6:24 pm
by reninkidney
So, my partner and I were taking a test, and we came across this question:
37. Suppose the trait of dimples runs in a family line. John, a male with dimples marries Mary, a female
that’s younger than John and has no dimples. Both heterozygotes, that have 4 children, (listed youngest to
oldest), Lucy, an unaffected female; Andy, a male with dimples; Jordan, an unaffected male; and
Veronica, a female with no dimples. The 2nd oldest out of the 4 siblings marries a younger, unaffected
female, and has 3 daughters, the youngest with dimples. The youngest out of the 4 siblings marries a
younger male called Jake, who doesn’t know whether or not he has dimples. Jake's parents, listed from
birth date, are Jeff, with no dimples, and Amy, with dimples. Jake and the youngest of the 4 siblings have
3 unaffected children, the oldest and youngest are sons, and the middle being a daughter.
a. Construct a pedigree for this situation.
b. What type of inheritance is shown?
We were confused when we saw this question because, in the question, it states that John and Mary are both heterozygotes, but John has dimples and Mary doesn't. That didn't make much sense to us. We assumed that John was affected and Mary wasn't, and we drew the pedigree. Looking at the pedigree that we drew, it looked like it was autosomal recessive (equal amounts of girls & boys affected and skips generations), but the key said it was autosomal dominant. When we looked at the key, we noticed that Jordan was marked as affected in the pedigree while in the problem, he was described as being unaffected.
Can anybody please explain what we had done wrong?
Re: Heredity B
Posted: December 26th, 2019, 8:08 pm
by Mr.Epithelium
reninkidney wrote: ↑December 26th, 2019, 6:24 pm
So, my partner and I were taking a test, and we came across this question:
37. Suppose the trait of dimples runs in a family line. John, a male with dimples marries Mary, a female
that’s younger than John and has no dimples. Both heterozygotes, that have 4 children, (listed youngest to
oldest), Lucy, an unaffected female; Andy, a male with dimples; Jordan, an unaffected male; and
Veronica, a female with no dimples. The 2nd oldest out of the 4 siblings marries a younger, unaffected
female, and has 3 daughters, the youngest with dimples. The youngest out of the 4 siblings marries a
younger male called Jake, who doesn’t know whether or not he has dimples. Jake's parents, listed from
birth date, are Jeff, with no dimples, and Amy, with dimples. Jake and the youngest of the 4 siblings have
3 unaffected children, the oldest and youngest are sons, and the middle being a daughter.
a. Construct a pedigree for this situation.
b. What type of inheritance is shown?
We were confused when we saw this question because, in the question, it states that John and Mary are both heterozygotes, but John has dimples and Mary doesn't. That didn't make much sense to us. We assumed that John was affected and Mary wasn't, and we drew the pedigree. Looking at the pedigree that we drew, it looked like it was autosomal recessive (equal amounts of girls & boys affected and skips generations), but the key said it was autosomal dominant. When we looked at the key, we noticed that Jordan was marked as affected in the pedigree while in the problem, he was described as being unaffected.
Can anybody please explain what we had done wrong?
Don't worry! You were right in constructing the pedigree. The pedigree described in the test and key do not match up, and many people's genotypes are ambiguous. I definitely made mistakes when writing this question and the key, and I apologize if this caused any confusion

.
Thanks for catching that mistake, I always post errata (and other tests) on my wiki page:
https://scioly.org/wiki/index.php/User:Mr.Epithelium
Re: Heredity B
Posted: December 28th, 2019, 7:52 pm
by reninkidney
Mr.Epithelium wrote: ↑December 26th, 2019, 8:08 pm
reninkidney wrote: ↑December 26th, 2019, 6:24 pm
So, my partner and I were taking a test, and we came across this question:
37. Suppose the trait of dimples runs in a family line. John, a male with dimples marries Mary, a female
that’s younger than John and has no dimples. Both heterozygotes, that have 4 children, (listed youngest to
oldest), Lucy, an unaffected female; Andy, a male with dimples; Jordan, an unaffected male; and
Veronica, a female with no dimples. The 2nd oldest out of the 4 siblings marries a younger, unaffected
female, and has 3 daughters, the youngest with dimples. The youngest out of the 4 siblings marries a
younger male called Jake, who doesn’t know whether or not he has dimples. Jake's parents, listed from
birth date, are Jeff, with no dimples, and Amy, with dimples. Jake and the youngest of the 4 siblings have
3 unaffected children, the oldest and youngest are sons, and the middle being a daughter.
a. Construct a pedigree for this situation.
b. What type of inheritance is shown?
We were confused when we saw this question because, in the question, it states that John and Mary are both heterozygotes, but John has dimples and Mary doesn't. That didn't make much sense to us. We assumed that John was affected and Mary wasn't, and we drew the pedigree. Looking at the pedigree that we drew, it looked like it was autosomal recessive (equal amounts of girls & boys affected and skips generations), but the key said it was autosomal dominant. When we looked at the key, we noticed that Jordan was marked as affected in the pedigree while in the problem, he was described as being unaffected.
Can anybody please explain what we had done wrong?
Don't worry! You were right in constructing the pedigree. The pedigree described in the test and key do not match up, and many people's genotypes are ambiguous. I definitely made mistakes when writing this question and the key, and I apologize if this caused any confusion

.
Thanks for catching that mistake, I always post errata (and other tests) on my wiki page:
https://scioly.org/wiki/index.php/User:Mr.Epithelium
No problem. Thanks for taking the time to go back and check!
Re: Heredity B
Posted: December 30th, 2019, 8:33 am
by donutsandcupcakes
Phenakism wrote: ↑November 16th, 2019, 6:01 pm
How much do we have to know about protein synthesis for this event?
same question here..